View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17833_high_107 (Length: 249)
Name: NF17833_high_107
Description: NF17833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17833_high_107 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 2 - 226
Target Start/End: Original strand, 29189598 - 29189822
Alignment:
| Q |
2 |
tataccggcgtgacacccatatttatgattacagtgaattatgttaattttttgaaaaattatccgtgtctgatgccgtgtctgcgtccgtgcttcatag |
101 |
Q |
| |
|
||||||| | |||||||||||||| ||||||||||||||||||| ||||||||||||||||||| | || | |||||||||||||||||| |||||||| |
|
|
| T |
29189598 |
tataccgacatgacacccatatttgtgattacagtgaattatgtcaattttttgaaaaattatctatatccggtgccgtgtctgcgtccgtccttcatag |
29189697 |
T |
|
| Q |
102 |
aaactcagtatatgtttgcttattttgtctctatggtgtttctacagctgagtcttggtttgcagctgatacatcaagtggatatcttgaagatgcaatc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29189698 |
aaactcagtatatgtttgcttattttgtctctatggtgtttctacagctgagtcttggtttgcagctgatacatctagtggatatcttgaagatgcaatc |
29189797 |
T |
|
| Q |
202 |
aatggctgggatatttggtgcaagc |
226 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
29189798 |
aatggctgggatatttggtgcaagc |
29189822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University