View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17833_high_119 (Length: 236)
Name: NF17833_high_119
Description: NF17833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17833_high_119 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 69 - 220
Target Start/End: Complemental strand, 16990694 - 16990543
Alignment:
| Q |
69 |
attcaaggcctatgctgtatgtttgttctgattgactgagatatatgtgataaaaggtattgattttttggcatacnnnnnnngtacatgacacagaatg |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
16990694 |
attcaaggcctatgctgtatgtttgttctgattgactgagatatatgtgataaaaggtattgatttttttgcatactttttttgtacatgacacagaatg |
16990595 |
T |
 |
| Q |
169 |
atagatgtcccaacgaaggttctggaaagagggctttatctgatgattcagt |
220 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16990594 |
atagatgtcccgataaaggttctggaaagagggctttatctgatgattcagt |
16990543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 16990737 - 16990690
Alignment:
| Q |
1 |
tacgttgatgtagtgtttatttccataaatttcttgttttgagattca |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16990737 |
tacgttgatgtagtgtttatttccataaatttcttgttttgagattca |
16990690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 220
Target Start/End: Complemental strand, 16966431 - 16966363
Alignment:
| Q |
152 |
gtacatgacacagaatgatagatgtcccaacgaaggttctggaaagagggctttatctgatgattcagt |
220 |
Q |
| |
|
|||||||||||||| |||||||| |||| | ||||||| | ||||||| |||| || |||||||||||| |
|
|
| T |
16966431 |
gtacatgacacagattgatagatttccccatgaaggttatagaaagagagcttcatttgatgattcagt |
16966363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University