View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17833_high_78 (Length: 317)
Name: NF17833_high_78
Description: NF17833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17833_high_78 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 5e-53; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 125 - 291
Target Start/End: Complemental strand, 6943408 - 6943234
Alignment:
| Q |
125 |
agcttcttctgtttgctaacctcccggacgtttatggaaaatccaatacctttacatgaatgcccgtaaatatcaagaggtaagtttcaatcatttatcc |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||| ||||| ||||||||||||||||||| ||| |
|
|
| T |
6943408 |
agcttcttctgtttgctaacctcccggacgtttatggaaaatccaatacctcttcatgaatgcctgtaattatcatgaggtaagtttcaatcattaatct |
6943309 |
T |
 |
| Q |
225 |
cttggagacttggctaattgctgcacagttttt--------acatggatctttgtatggttgtaacttaatgcat |
291 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| | ||||||||||||||||||| |||||||||||| |
|
|
| T |
6943308 |
cttggagacttagctaattgctgcacagtttttaaaaattgatatggatctttgtatggttgaaacttaatgcat |
6943234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 51 - 183
Target Start/End: Original strand, 6787326 - 6787458
Alignment:
| Q |
51 |
aaggagagattgcagctgaagaacaaagtaactgcaagagcttgtcttgacttaacagccaagttttcaaaatcagcttcttctgtttgctaacctcccg |
150 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||| || ||||||| ||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
6787326 |
aaggatagattgcagctgaagaacaaagtaactgcaagagcatgtcctgtcttaacaaccaagttttcaaaatcagcttgttttgtttgctaacctcccg |
6787425 |
T |
 |
| Q |
151 |
gacgtttatggaaaatccaatacctttacatga |
183 |
Q |
| |
|
||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
6787426 |
gacgtttatggaatatccaattccttttcatga |
6787458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 125 - 198
Target Start/End: Complemental strand, 6940212 - 6940139
Alignment:
| Q |
125 |
agcttcttctgtttgctaacctcccggacgtttatggaaaatccaatacctttacatgaatgcccgtaaatatc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
6940212 |
agcttcttctgtttgctaacctcccggacgtttatggaaaatccaataccttttcatgaatgcctgtaattatc |
6940139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 93
Target Start/End: Complemental strand, 6943478 - 6943404
Alignment:
| Q |
19 |
gagacactcccaaccaattcatcatcagtggcaaggagagattgcagctgaagaacaaagtaactgcaagagctt |
93 |
Q |
| |
|
||||| ||| |||||| ||||||||||||| ||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
6943478 |
gagaccctctcaaccatttcatcatcagtgtcaaggagagattgcatctcaagaacaaagtaactgcaagagctt |
6943404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 31 - 124
Target Start/End: Original strand, 6859391 - 6859485
Alignment:
| Q |
31 |
accaattcatcatcagtggcaaggagagattgcagctgaagaaca-aagtaactgcaagagcttgtcttgacttaacagccaagttttcaaaatc |
124 |
Q |
| |
|
|||| |||||||||||| ||||||||||| ||||||||||||||| ||| || ||||| ||| | || || ||| |||| ||||||||||||||| |
|
|
| T |
6859391 |
accatttcatcatcagtagcaaggagagaatgcagctgaagaacagaagaaattgcaacagcatctcctgtcttgacaggcaagttttcaaaatc |
6859485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 37 - 93
Target Start/End: Complemental strand, 6940263 - 6940208
Alignment:
| Q |
37 |
tcatcatcagtggcaaggagagattgcagctgaagaacaaagtaactgcaagagctt |
93 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||| ||||||||| |||||||| |
|
|
| T |
6940263 |
tcatcatcagtgtcaaggagagattgcatctgaagaac-aagtaactgaaagagctt |
6940208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 75
Target Start/End: Complemental strand, 6138955 - 6138905
Alignment:
| Q |
25 |
ctcccaaccaattcatcatcagtggcaaggagagattgcagctgaagaaca |
75 |
Q |
| |
|
|||||| ||| |||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
6138955 |
ctcccagccatttcatcatcagtggtgaggagagaatgcagctgaagaaca |
6138905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 75
Target Start/End: Complemental strand, 6234061 - 6234011
Alignment:
| Q |
25 |
ctcccaaccaattcatcatcagtggcaaggagagattgcagctgaagaaca |
75 |
Q |
| |
|
|||||| ||| ||||||||||| ||| |||||||| ||||||||||||||| |
|
|
| T |
6234061 |
ctcccagccatttcatcatcagcggcgaggagagaatgcagctgaagaaca |
6234011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 77
Target Start/End: Complemental strand, 6164261 - 6164220
Alignment:
| Q |
36 |
ttcatcatcagtggcaaggagagattgcagctgaagaacaaa |
77 |
Q |
| |
|
|||||| |||||||| |||||||| ||||||||||||||||| |
|
|
| T |
6164261 |
ttcatcgtcagtggcgaggagagaatgcagctgaagaacaaa |
6164220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 219 - 256
Target Start/End: Complemental strand, 6940143 - 6940106
Alignment:
| Q |
219 |
ttatcccttggagacttggctaattgctgcacagtttt |
256 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
6940143 |
ttatctcttggagacttagctaattgctgcacagtttt |
6940106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University