View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17833_high_79 (Length: 316)
Name: NF17833_high_79
Description: NF17833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17833_high_79 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 10 - 298
Target Start/End: Complemental strand, 47838133 - 47837845
Alignment:
| Q |
10 |
acatcatcatttatacaacaaagggtgtataatttacaataggaatttgtcatttatcatcttggaacatgaatacttcacctgagctgggactgccttt |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47838133 |
acatcataatttatacaacaaagggtgtataatttacaataggaatttgtcatttatcatcttggaacatgaatacttcacctgagctgggactgccttt |
47838034 |
T |
|
| Q |
110 |
gccaattgggcaggtagttctgttatactagtaaacactgatagttgactgataatagacccggtaaaaacattgacaaaaaacacattccaaatggtga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47838033 |
gccaattgggcaggtagttctgttatactagtaaacactgatagttgactgataatagacccggtaaaaacattgacaaaaaacacattccaaatggtga |
47837934 |
T |
|
| Q |
210 |
aatacacaactttgcagcatgcacttttcttcttgccgctacgggaaattggcccttcaactgctgaaagtaacatcatcactggtcca |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47837933 |
aatacacaactttgcagcatgcacttttcttcttgccgctacgggaaattggcccttcaactgctgaaagtaacatcatcactggtcca |
47837845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 88 - 295
Target Start/End: Original strand, 4705571 - 4705778
Alignment:
| Q |
88 |
cacctgagctgggactgcctttgccaattgggcaggtagttctgttatactagtaaacactgatagttgactgataatagacccggtaaaaacattgaca |
187 |
Q |
| |
|
|||||||||||| ||||||||||| | | ||||| || ||| ||| |||| ||| ||||| |||||||| |||| ||| || || |||||||| | | |
|
|
| T |
4705571 |
cacctgagctggcactgcctttgcaagtgttgcaggcagctcttttaagctagaaaagactgaaagttgacttataagagaaccagttaaaacattaata |
4705670 |
T |
|
| Q |
188 |
aaaaacacattccaaatggtgaaatacacaactttgcagcatgcacttttcttcttgccgctacgggaaattggcccttcaactgctgaaagtaacatca |
287 |
Q |
| |
|
|||||||||||||| || ||||| |||| |||||| || ||||||||||||||| | || || |||||||| || || ||||||| ||||| || ||||| |
|
|
| T |
4705671 |
aaaaacacattccagattgtgaagtacaaaactttccaacatgcacttttcttccttccactgcgggaaataggaccctcaactgttgaaaatagcatca |
4705770 |
T |
|
| Q |
288 |
tcactggt |
295 |
Q |
| |
|
||| |||| |
|
|
| T |
4705771 |
tcaatggt |
4705778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University