View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17833_high_80 (Length: 309)
Name: NF17833_high_80
Description: NF17833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17833_high_80 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 306
Target Start/End: Complemental strand, 47291105 - 47290811
Alignment:
| Q |
18 |
ttaagcagtctaatctaagtctgattattccttatttactaaaagctcttctgctgctttcactgnnnnnnnn------aattagtatgaatgatttatt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47291105 |
ttaagcagtctaatctaagtctgattattccttatttactaaaagctcttctgctgctttcactgttttttttttttttaattagtatgaatgatttatt |
47291006 |
T |
 |
| Q |
112 |
aatttatggtaacaatctttctgaacttaacagtgttaaaaaagatttagtgttctcaggtatttttcgagttttgaaaccgcaagatccaagagaggaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47291005 |
aatttatggtaacaatctttctgaacttaacagtgttaaaaaagatttagtgttctcagttatttttcgagttttgaaaccgcaagatccaagagaggaa |
47290906 |
T |
 |
| Q |
212 |
tttccttataggaaacagattggcaagcttctttatttaactccttctcgtcgtgacatttctttttcagtttgtaggcttagttcatctctctc |
306 |
Q |
| |
|
|||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
47290905 |
tttccttacaggaagctgattggcaagcttctttatttaactccttctcgtcgtgacatttctttttcagtttgtaggcttagtccatatctctc |
47290811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University