View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17833_high_92 (Length: 275)
Name: NF17833_high_92
Description: NF17833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17833_high_92 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 5 - 260
Target Start/End: Original strand, 37977285 - 37977540
Alignment:
| Q |
5 |
tacactcatgcctatgttttgcaaactctatgatggactattttggtaggtggtctaccgtggactgaaacttgaaaatcgttggacatttcaatgatgg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37977285 |
tacactcatgcctatgttttgcaaactctatgatggactattttggtaggtggtctaccgtggactgaaacttgaaaatcgttggacatttcaatgatgg |
37977384 |
T |
|
| Q |
105 |
ttgaaactgtctttcgaaaatagaaggtctcaatccaccttgtcaatcagacggtgacttgatcaatctcacttcaacaaaaataagggatacgcgtgct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |
|
|
| T |
37977385 |
ttgaaactgtctttcgaaaatagaaggtctcaatccaccttgtcaatcagacggtgacttgatcaatctcacttcaacaaaaataagggatatgcgtggt |
37977484 |
T |
|
| Q |
205 |
tcaaaactcaactcatatccgcttttccatgctttggtcaaattgacactgatcaa |
260 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37977485 |
tcaaaactcaactcatatccgtttttccatgctttggtcaaattgacactgatcaa |
37977540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University