View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17833_high_98 (Length: 265)
Name: NF17833_high_98
Description: NF17833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17833_high_98 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 46289550 - 46289298
Alignment:
| Q |
1 |
cttctgttcccgtaaaacagtgtctccatattacgtttgttctcatctttaatgcacaaatatgctttcgctctgttcactttgtttcctatcccaattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
46289550 |
cttctgttcccgtaaaacagtgtctccatattgcgtttgttctcatctttaatgcacaaatatgctttccctctgttcactttgtttcctatcacaattg |
46289451 |
T |
 |
| Q |
101 |
aaacttctgaaggagtagagtcaagtccgtacgctctatgagagcttttcattacgagatatgctgcatatgatgtgtttggcgttagaatcttcgttct |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46289450 |
aaacttctgtaggagtagagtcaagtccgtacgctctatgagaacttttcattacgagatatgctgcatatgatgtgtttggcgttagaatcttcgttct |
46289351 |
T |
 |
| Q |
201 |
aattctgccttctatttctaaccagttcactgttctcagttctgccacctctg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46289350 |
aattctgccttctatttctaaccagttcactgttctcagttctgccacctctg |
46289298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University