View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17833_low_112 (Length: 250)
Name: NF17833_low_112
Description: NF17833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17833_low_112 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 39540522 - 39540764
Alignment:
| Q |
1 |
ccctccctaataccttgattaccctttttggcatcatccttcttcttgccccattcatgtagcctcaaatgcagctcagcagctgcaatcaagaagtgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39540522 |
ccctccctaataccttgattaccctttttggcatcatccttcttcttgccccattcatgtagcctcaagtgcagctcagcagctgcaatcaagaagtgaa |
39540621 |
T |
 |
| Q |
101 |
tagcttgttttggagtcagaatattgacaatgccctgcaaagctctcagccttaaatcatcagctctataaagaatcttttccaaaccttccatcttagg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39540622 |
tagcttgttttggagtcagaatattgacaatgccctgcaaagctctcagccttaaatcatcagctctataaagaatcttttccaaaccttccaccttagg |
39540721 |
T |
 |
| Q |
201 |
ttcaagaactgattcaattctctcttccaattccttcatctca |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39540722 |
ttcaagaactgattcaattctctcttccaattccttcttctca |
39540764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University