View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17833_low_123 (Length: 238)
Name: NF17833_low_123
Description: NF17833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17833_low_123 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 39540486 - 39540353
Alignment:
| Q |
1 |
cattgaattcttcaatcaaagggagtttgggtgagggtaccttatctagcactacctaggattttatgtttatgtaaatgttcattaagatgaagaaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39540486 |
cattgaattcttcaatcaaagggagtttgggtgagggtaccttatctagcactacctaggattttatgtttatgtaaattttcattaagatgaagaaaaa |
39540387 |
T |
 |
| Q |
101 |
taaggaaacatatattcttcattttgatgtagca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39540386 |
taaggaaacatatattcttcattttgatgtagca |
39540353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University