View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17833_low_126 (Length: 227)
Name: NF17833_low_126
Description: NF17833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17833_low_126 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 23 - 212
Target Start/End: Original strand, 6323931 - 6324113
Alignment:
| Q |
23 |
gttagaatattaacaataaaaattatatagtattgcccttcaactcataatgtaaactaggattgcgagatgaaatgctaattggaatgttacaattacc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6323931 |
gttagaatattaacaataaaaattatatagtattgcccttcaactcataatgtaaactaggattgcgagatgaaatgctaattggaatgttacaattacc |
6324030 |
T |
 |
| Q |
123 |
attgagatttgagaatgaaatatgaaactttttgagttaaggcgagaacaaaagttgtatagtattgccattaccgacaattaccctttg |
212 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6324031 |
a-------ttgagaatgaaatatgaaactttttgagttaaggcgagaacaaaagttgtatagtattgccattaccgacaattaccctttg |
6324113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University