View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17833_low_126 (Length: 227)

Name: NF17833_low_126
Description: NF17833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17833_low_126
NF17833_low_126
[»] chr2 (1 HSPs)
chr2 (23-212)||(6323931-6324113)


Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 23 - 212
Target Start/End: Original strand, 6323931 - 6324113
Alignment:
23 gttagaatattaacaataaaaattatatagtattgcccttcaactcataatgtaaactaggattgcgagatgaaatgctaattggaatgttacaattacc 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6323931 gttagaatattaacaataaaaattatatagtattgcccttcaactcataatgtaaactaggattgcgagatgaaatgctaattggaatgttacaattacc 6324030  T
123 attgagatttgagaatgaaatatgaaactttttgagttaaggcgagaacaaaagttgtatagtattgccattaccgacaattaccctttg 212  Q
    |       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6324031 a-------ttgagaatgaaatatgaaactttttgagttaaggcgagaacaaaagttgtatagtattgccattaccgacaattaccctttg 6324113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University