View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17833_low_54 (Length: 393)
Name: NF17833_low_54
Description: NF17833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17833_low_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 154 - 375
Target Start/End: Complemental strand, 12818810 - 12818589
Alignment:
| Q |
154 |
atcacttcaaaaccctaatttattaaaaccaaccaagaatttcacttcacttcttggaaatcctaaacttctctttctctcaattatttcttctccgaaa |
253 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12818810 |
atcacttcaaaaccctaatttattataaccaaccaagaatttcacttcacttcttggaaatcctaaacttctctttctctcaattatttcttcttcgaaa |
12818711 |
T |
|
| Q |
254 |
ccctaactttcaaaatttcaatgtctgattcaaattcaccacgtggtgaacaagaacaagaacaaaaagagaatcaaatgaattcatcttcaatgatgag |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12818710 |
ccctaactttcaaaatttcaatgtctgattcaaattcaccacgtggtgaacaagaacaagaacaagaagagaatcaaatgaattcatcttcaatgatgag |
12818611 |
T |
|
| Q |
354 |
ttcaatttctgaaaccctagat |
375 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12818610 |
ttcaatttctgaaaccctagat |
12818589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 14 - 43
Target Start/End: Complemental strand, 12818950 - 12818921
Alignment:
| Q |
14 |
cagagagagaaagagaaagagcgcgatgtc |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12818950 |
cagagagagaaagagaaagagcgcgatgtc |
12818921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University