View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17833_low_81 (Length: 317)
Name: NF17833_low_81
Description: NF17833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17833_low_81 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 11 - 300
Target Start/End: Complemental strand, 37753935 - 37753646
Alignment:
| Q |
11 |
cacagacacaactcagttaccctacttgtctcacagaggaatttgcttctccttataattggtgttcttgcgatggcatcatttgtctcaccactgatta |
110 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37753935 |
cacagacacaactcacttaccctacttgtctcacagaggaatttgcttctccttatgaatggtgttcttgcgatggcatcatttgtctcaccactgatta |
37753836 |
T |
|
| Q |
111 |
tagttccgctgttttgtggaaccctttcattaataaattcaaaacattgcctcctttaaaatatatttcactgaaaagaactccttcttccttatttact |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |||||||||| |
|
|
| T |
37753835 |
tagttccgctgttttgtggaaccctttcattaataaattcaaaacattgcctcctttaaaatatatttcactgaaaagatcgccttcttgcttatttact |
37753736 |
T |
|
| Q |
211 |
tttgggtatgatcctttcgccgataattataaggtttttgctattaccttttgtgtcaagagaactacagttgaagttcatactatgggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37753735 |
tttgggtatgatcctttcgccgataattataaggtttttgctattaccttttgtgtcaagagaactacagttgaagttcatactatgggt |
37753646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 167
Target Start/End: Complemental strand, 37758265 - 37758171
Alignment:
| Q |
72 |
gtgttcttgcgatggcatcatttgtctcaccactgattatagttccgctgttttgtggaaccctttcattaataaattcaaaacattgcctccttt |
167 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| | || ||||||| || |||||| |||||||| ||||||||||| ||| | ||||||||||| |
|
|
| T |
37758265 |
gtgttcttgcgacggcatcatttgtttcaccattaatgatagttctgcccttttgt-gaacccttccattaataaatccaagatgttgcctccttt |
37758171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 74 - 167
Target Start/End: Complemental strand, 9608892 - 9608799
Alignment:
| Q |
74 |
gttcttgcgatggcatcatttgtctcaccactgattatagttccgctgttttgtggaaccctttcattaataaattcaaaacattgcctccttt |
167 |
Q |
| |
|
||||||||||||| ||| |||| ||||||| ||| || |||||||| ||||||||||||||| ||| | ||||| | || |||||||||||| |
|
|
| T |
9608892 |
gttcttgcgatggaatcctttgcctcaccatagatgatggttccgctattttgtggaacccttccatcagaaaattaacaaaattgcctccttt |
9608799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 118 - 167
Target Start/End: Complemental strand, 772006 - 771957
Alignment:
| Q |
118 |
gctgttttgtggaaccctttcattaataaattcaaaacattgcctccttt |
167 |
Q |
| |
|
||||||||||||||||||| |||| | |||||||| | |||||||||||| |
|
|
| T |
772006 |
gctgttttgtggaacccttccattcaaaaattcaagatattgcctccttt |
771957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University