View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17833_low_95 (Length: 280)
Name: NF17833_low_95
Description: NF17833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17833_low_95 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 13 - 263
Target Start/End: Original strand, 42251071 - 42251325
Alignment:
| Q |
13 |
aatatatatttttgaattaattaattagtatattttgacgggtatgtgtcgaaatcatttgtatttaggattccgaccaagtaatagctgtcactctatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42251071 |
aatatatatttttgaattaattaattagtatattttgacgggtatgtgtcgaaataatttgtatttaggattccgaccaagtaatagctgtcactctatt |
42251170 |
T |
|
| Q |
113 |
tacacccaaacattttcaaccatttattactatttattcataaagtttcttgttaaaggaatattatgttgtagaatctgaggaaatattaccagt---- |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42251171 |
tacacccaaacattttcaatcatttattactatttattcataaagtttcttgttaaaggaatattatgttgtagaatctgaggaaatattaccagtatga |
42251270 |
T |
|
| Q |
209 |
atgaatagaccacattgaacgaaaattactagaccacattgttagtgcaagattt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42251271 |
atgaatagaccacattgaacgaaaattactagaccacattgttagtgcaagattt |
42251325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University