View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17834_high_8 (Length: 230)
Name: NF17834_high_8
Description: NF17834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17834_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 38 - 198
Target Start/End: Complemental strand, 10572382 - 10572222
Alignment:
| Q |
38 |
ctaaaagataatcaggtctaccataaagcccaagagaagcccattcaggattgaaccatatgatgaataaattatctaaacttatcctgaaaataaattt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10572382 |
ctaaaagataatcaggtctaccataaagcccaagagaagcccattcaggattgaaccatatgatgaataaattatctaaacttatcctgaaaataaattt |
10572283 |
T |
 |
| Q |
138 |
gaatttcataacgattcccggtataannnnnnnnaaacatgcaccaaattatatctcacca |
198 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10572282 |
gaatttcataacgattcccggtataattttttttaaacatgcaccaaattatatctcacca |
10572222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University