View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17834_low_11 (Length: 266)
Name: NF17834_low_11
Description: NF17834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17834_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 683579 - 683830
Alignment:
| Q |
1 |
atatctttagctggtcatagcatgggaagtgctttagctattttacttgcttatgatatttcagagctaggtttaaacnnnnnnn-tgataaaaatgatg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
683579 |
atatctttagctggtcatagcatgggaagtgctttagctattttacttgcttatgatatttcagagctaggtttaaacaaaaaaaatgacaaaaatgatg |
683678 |
T |
|
| Q |
100 |
ccagtgttacagttttttcatttggaggacctagggttggtaacttagagtttnnnnnnngatgtgaagagttaggtgtgaaagtgttgagaatatcaaa |
199 |
Q |
| |
|
| ||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
683679 |
ctagtgttacagtattttcatttggaggaccaagggttggtaacttagagtttaaaaaaagatgtgaagagttaggtgtgaaagtgttgagaatatcaaa |
683778 |
T |
|
| Q |
200 |
tgttaatgatcctataacaaaactaccgggtgttgtattcaatgaaaatttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
683779 |
tgttaatgatcctataacaaaactaccgggtgttgtattcaatgaaaatttt |
683830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University