View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17834_low_6 (Length: 369)
Name: NF17834_low_6
Description: NF17834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17834_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 48565225 - 48565444
Alignment:
| Q |
1 |
atgcataccgattcacttggtagtttaataaaattattttttgttagttcatattgatttacattatcttgcggtgcaaacttataaaaactaaacattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48565225 |
atgcataccgattcacttggtagtttaataaaattattttttgttagttcatattgatttacattatcttgcggtgcaaacttataaaaactaaacattt |
48565324 |
T |
|
| Q |
101 |
gatgacttctgcatgctaactaacataagtctttttcatttaatctgagttatttaaataccgctagtgaatttccgagatttctacagtctagtctaac |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48565325 |
gatgacttctacatgctaactaacataagtc-ttttcatttaatctgag----ttaaataccgctagtgaatttccgagatttctacagtctagtctaac |
48565419 |
T |
|
| Q |
201 |
catgatgaccaaaggcttattctat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48565420 |
catgatgaccaaaggcttattctat |
48565444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 237 - 297
Target Start/End: Original strand, 48565488 - 48565548
Alignment:
| Q |
237 |
tgagggatgggaaattgaatcatcatatttgaagtgtgtgcaatctccctcttttttctct |
297 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48565488 |
tgaggtatgggaaattgaatcatcatatttgaagtgtgtgcaatctccctcttttttctct |
48565548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University