View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17835_high_14 (Length: 221)
Name: NF17835_high_14
Description: NF17835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17835_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 8 - 143
Target Start/End: Complemental strand, 7496759 - 7496623
Alignment:
| Q |
8 |
ataaaagaccatatttattttcaattgttactattggatatttcaa-gtttatgatgcactcttactactgaattaactctaattaaacttgacactctt |
106 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| | ||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
7496759 |
ataaaagaccctatttattttcaattgttactattggatatttcaaagtttatgatgcagttttagtactgaattaactctcattaaacttgacactctt |
7496660 |
T |
 |
| Q |
107 |
tcatgtctgaaatctgaatcatagcttgagctttggg |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7496659 |
tcatgtctgaaatctgaatcatagcttgagctctggg |
7496623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 213
Target Start/End: Complemental strand, 7496626 - 7496575
Alignment:
| Q |
162 |
tgggcgggaacatcaagctactctccacgttatctttccatctcctactatc |
213 |
Q |
| |
|
||||||||||||||| ||||||||| || ||||||||| |||||||||||| |
|
|
| T |
7496626 |
tgggcgggaacatcacgctactctcaacaatatctttccttctcctactatc |
7496575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University