View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17835_low_10 (Length: 316)
Name: NF17835_low_10
Description: NF17835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17835_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 14 - 298
Target Start/End: Original strand, 8893805 - 8894089
Alignment:
| Q |
14 |
ataattctcatccaacaccaaaccattcaaaacatccaccgaaactggaaccggcacgcctcctaaaactggtgataccgacacggtttcatgcttctcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8893805 |
ataattctcatccaacaccaaaccattcaaaacatccaccgaaactggaaccggcacgcctcctaaaactggtgataccgacacggtttcatgcttctcc |
8893904 |
T |
|
| Q |
114 |
aagtaaagcgacggaagcatatgatgaggtgtaatcggatggtttctatatgacacaaaggtggaaagcctgtcaaagtaaatggatactcgcttgtttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8893905 |
aagtaaagcgacggaagcatatgatgaggtgtaatcggatggtttctatatgacacaaaggtggaaagcctgtcaaagtaaatggatactcgcttgtttg |
8894004 |
T |
|
| Q |
214 |
gattccttatgaagattgtgaattgcattgagattgacatgtctggtggtgaagttgcattgaggccatagatagcagcacttgt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
8894005 |
gattccttatgaagattgtgaattgcattgagattgacatgtctggcggtgaagtagcattgaggctatagattgcagcacttgt |
8894089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University