View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17835_low_11 (Length: 308)
Name: NF17835_low_11
Description: NF17835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17835_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 292
Target Start/End: Complemental strand, 15629521 - 15629230
Alignment:
| Q |
1 |
ttcgccttctgataatacagaagaaacctacttataacataatgatccaatttactcgaaagcattgactttaccaacatgataaccatctggggagtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15629521 |
ttcgccttctgataatacagaagaaacctacttataacataatgatccaatttactcgaaagcattgactttaccaacatgataaccatctggggagtca |
15629422 |
T |
|
| Q |
101 |
aaaacaagagatcttcaaaccaccatgtcgaacgagtgaaattcgtctttatactctcagtacttttcgagtcacacgaaaacctaatccctgaactgtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15629421 |
aaaacaagagatcttcaaaccaccatgtcgaacgagtgaaattcgtcttaatactctcagtacttttcgagtcacacgaaaacctaatccctgaactgtc |
15629322 |
T |
|
| Q |
201 |
gttcgaacaacttgatggacacggacttgcttcactcgccgaaaccagcctcccaactacaccatccaaacacttctctagcatcacagaag |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15629321 |
gttcgaacaacttgatggacacggacttgcttcactcgccgaaaccagcctcccaactacagcatccaaacacttctctagcatcacagaag |
15629230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University