View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17835_low_16 (Length: 251)
Name: NF17835_low_16
Description: NF17835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17835_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 7 - 236
Target Start/End: Complemental strand, 39076901 - 39076674
Alignment:
| Q |
7 |
aagcaaaggttgtagttacaaaacaaaatatgtctaaaaagttcaatttacnnnnnnngttgaaccacnnnnnnnncttcttcaaaactagatacagttg |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
39076901 |
aagccaaggttgtagttacaaaacaaaatatgtctaaaaagttcaatttacaaaaaaagttgaaccacttttttt--ttcttcaaaactagatacagttg |
39076804 |
T |
|
| Q |
107 |
gcatattaatgattgatttttgcctttatttctaataatgtaacttaatatatttataggcttcttaattcagcagcgagatccttttctgcagtttagt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076803 |
gcatattaatgattgatttttgcctttatttctaataatgtaacttaatatatttaaaggcttcttaattcagcagcgagatccttttctgcagtttagt |
39076704 |
T |
|
| Q |
207 |
gatcctgctgatgcagtgagagatgctact |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39076703 |
gatcctgctgatgcagtgagagatgctact |
39076674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University