View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17836_high_37 (Length: 286)
Name: NF17836_high_37
Description: NF17836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17836_high_37 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 19 - 286
Target Start/End: Complemental strand, 42022256 - 42021990
Alignment:
| Q |
19 |
agcgttaacatcagcccgccctgatgtgccaatattcccatctacaatttcatctgtaacttttcaaggcaaagtaaaatgaagtagtagctttagcaga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42022256 |
agcgttaacatcagcccgccctgatgtgccaatat-cccatctacaatttcatctgtaacttttcaaggcaaagtaaaatgaagtagtagctttagcaga |
42022158 |
T |
 |
| Q |
119 |
cctcgatattagttgaacaatcgatgtttccatcgattgctcaagcatgagtagttggtcaacctcttgtggtaccttaatatttgtgggaggtgtgtct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42022157 |
cctcgatattagttgaacaatcgatgtttccatcgattgctcaagcatgagtagttggtcaacctcttgtggtaccttaatatttgtgggaggtgtgtct |
42022058 |
T |
 |
| Q |
219 |
gtagccttctccaagtaaataattgttatttagttcttggatgtcgtcgtgacatctttcttagtgac |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42022057 |
gtagccttctccaagtaaataattgttatttagttcttggatgtcgtcgtgacatctttcttagtgac |
42021990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University