View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17836_high_50 (Length: 242)
Name: NF17836_high_50
Description: NF17836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17836_high_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 19 - 156
Target Start/End: Original strand, 47818895 - 47819032
Alignment:
| Q |
19 |
cataggcgcggacattgatgattgggcatgaagtagaaggaaacatagaggcaaaagaacaagtagtaatttgggagagtcaaataatccaaatcccaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47818895 |
cataggcgcggacattgatgattgggcatgaagtagaaggaaacatagaggcaaaagaacaagtagtaatttgggagagtcaaataatccaaatcccaag |
47818994 |
T |
|
| Q |
119 |
aagcatatttatggggaaccctaatttgagagagagga |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47818995 |
aagcatatttatggggaaccctaatttgagagagagga |
47819032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University