View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17836_low_15 (Length: 467)
Name: NF17836_low_15
Description: NF17836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17836_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 420; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 420; E-Value: 0
Query Start/End: Original strand, 1 - 451
Target Start/End: Complemental strand, 50410767 - 50410323
Alignment:
| Q |
1 |
taataagtcaacactgttgactaaagattgttcatctttcactcaaggaagaggggatagttttcagaatcataaatcaacctccagttactttgctgga |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50410767 |
taataagtcaacattgttgactaaagattgttcatctttcactcaaggaagaggggatagttttcagaatcataaatcaacctccagttactttgctgga |
50410668 |
T |
 |
| Q |
101 |
tcttttcttccttggcattggtcagtgtttgcattctcatgctgttgttcattctaggattcaattatgttatcttctgtgctgactttttccccttccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50410667 |
tcttttcttccttggcattggtcagtgtttgcattctcatgctgttgttcattctaggattcaattatgttatcttctgtgctgactt------cttccc |
50410574 |
T |
 |
| Q |
201 |
cttccatacaggaaaatatacgatgtaaacattgataaatttgaggagaagccgtggaggattcccggtgctgacataacagattacttcaacttcggtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50410573 |
cttccatacaggaaaatatacgatgtaaacattgataaatttgaggagaagccgtggaggattcccggtgctgacataacagattacttcaacttcggtt |
50410474 |
T |
 |
| Q |
301 |
taaatgagaacacttggaagcaatactgttcgtctttggtgagttcatcacttcattttgtagcaatgtataaaaccagttaagttgtttgaccttgctt |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50410473 |
taaatgagaacacttggaagcaatactgttcgtctttggtgagttcatcacttcattttgtagcaatgtgtaaaaccagttaagttgtttgaccttgctt |
50410374 |
T |
 |
| Q |
401 |
actggatttggtattttcaggcatccacacaggagcaatttgatcaacctg |
451 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50410373 |
actggatttggtattttcaggcatccacacaggagcaatttgatcaacctg |
50410323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University