View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17836_low_33 (Length: 351)
Name: NF17836_low_33
Description: NF17836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17836_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 17 - 265
Target Start/End: Original strand, 47818784 - 47819032
Alignment:
| Q |
17 |
atatacaggtattaaaccataggaatttccatttatgaaaggagtcgaattggaggaattaaactaagaatatatcaaaattgaaagtggaaaagcaagt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47818784 |
atatacaggtattaaaccataggaatttccatttatgaaaggagtcgaattggaggaattaaactaagaatatatcaaaattgaaagtggaaaagcaagt |
47818883 |
T |
|
| Q |
117 |
agttcacctaacataggcgcggacattgatgattgggcatgaagtagaaggaaacatagaggcaaaagaacaagtagtaatttgggagagtcaaataatc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47818884 |
agttcacctaacataggcgcggacattgatgattgggcatgaagtagaaggaaacatagaggcaaaagaacaagtagtaatttgggagagtcaaataatc |
47818983 |
T |
|
| Q |
217 |
caaatcccaagaagcatatttatggggaaccctaatttgagagagagga |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47818984 |
caaatcccaagaagcatatttatggggaaccctaatttgagagagagga |
47819032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University