View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17836_low_40 (Length: 314)
Name: NF17836_low_40
Description: NF17836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17836_low_40 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 10 - 314
Target Start/End: Original strand, 48649665 - 48649969
Alignment:
| Q |
10 |
catcatcattcatcaaattccttctttcttatagactgactagttagtattaattagtagcagccgggtgaaccaactgatatttagagagatcaatcaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48649665 |
catcatcattcatcaaattccttctttcttatagactgactagttagtattaattagtagcagccgggtgaaccaactgatatttagagagatcaatcaa |
48649764 |
T |
|
| Q |
110 |
ttagattgatgatgggcagcaacaatggatcaccatcacagtttggggacacaacgctgacaaaagtgttcgttggaggtcttgcctgggaaactccgaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48649765 |
atagattgatgatgggcagcaacaatggatcaccatcacagtttggggacacaacgctgacaaaagtgttcgttggaggtcttgcctgggaaactccgaa |
48649864 |
T |
|
| Q |
210 |
agacacattaagagaacacttcgaaaaatacggagacatccttgaagctgtcataatttctgataaggttaccggcagatccaaagggtatggatttgta |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48649865 |
agacacattaagagaacacttcgaaaaatacggagacatccttgaagctgtcataatttctgataaggttaccggcagatccaaagggtatggatttgta |
48649964 |
T |
|
| Q |
310 |
acatt |
314 |
Q |
| |
|
||||| |
|
|
| T |
48649965 |
acatt |
48649969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 144 - 194
Target Start/End: Complemental strand, 43156206 - 43156156
Alignment:
| Q |
144 |
atcacagtttggggacacaacgctgacaaaagtgttcgttggaggtcttgc |
194 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
43156206 |
atcacagtttggggatacaacgctgactaaagtattcgttggaggtcttgc |
43156156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 144 - 194
Target Start/End: Complemental strand, 20286341 - 20286291
Alignment:
| Q |
144 |
atcacagtttggggacacaacgctgacaaaagtgttcgttggaggtcttgc |
194 |
Q |
| |
|
|||| |||||||||| ||||||||||| ||||| || |||||||||||||| |
|
|
| T |
20286341 |
atcatagtttggggatacaacgctgactaaagtatttgttggaggtcttgc |
20286291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 144 - 194
Target Start/End: Complemental strand, 21072970 - 21072920
Alignment:
| Q |
144 |
atcacagtttggggacacaacgctgacaaaagtgttcgttggaggtcttgc |
194 |
Q |
| |
|
|||| |||||||||| ||||||||||| ||||| || |||||||||||||| |
|
|
| T |
21072970 |
atcatagtttggggatacaacgctgactaaagtatttgttggaggtcttgc |
21072920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University