View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17836_low_56 (Length: 242)
Name: NF17836_low_56
Description: NF17836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17836_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 74 - 204
Target Start/End: Original strand, 47082641 - 47082771
Alignment:
| Q |
74 |
gtgatggccatgaagtattttcgcctttaggatagagcaaagaacccaacccaatgattctggggtgtttttcagttgttgcttctggagtaggcttccc |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47082641 |
gtgatggccatgaagtattttcgcctttaggatagagcaaagaacccaacccaatgattctggggtgtttttcagttgttgcttctggagtaggcttccc |
47082740 |
T |
 |
| Q |
174 |
agtagtagtacccgtttgtgatacgtcaaag |
204 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |
|
|
| T |
47082741 |
agtagtagtacgcgtttgtgatacgtcaaag |
47082771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 14 - 122
Target Start/End: Complemental strand, 47060072 - 47059964
Alignment:
| Q |
14 |
atattccaacagcaaaaccattacatttggggtaaaacccaaaagcaaaatggccagaacgtgatggccatgaagtattttcgcctttaggatagagcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||||||||| ||| || |
|
|
| T |
47060072 |
atattccaacagcaaaaccattacctttggggtaaaacccaaaagcaaaatggccagaacttgattgccatgaagtattttcacctttaggagcgaggaa |
47059973 |
T |
 |
| Q |
114 |
agaacccaa |
122 |
Q |
| |
|
||| ||||| |
|
|
| T |
47059972 |
agaccccaa |
47059964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 14 - 122
Target Start/End: Original strand, 47081730 - 47081838
Alignment:
| Q |
14 |
atattccaacagcaaaaccattacatttggggtaaaacccaaaagcaaaatggccagaacgtgatggccatgaagtattttcgcctttaggatagagcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||||||||| ||| || |
|
|
| T |
47081730 |
atattccaacagcaaaaccattacctttggggtaaaacccaaaagcaaaatggccagaacttgattgccatgaagtattttcacctttaggagcgaggaa |
47081829 |
T |
 |
| Q |
114 |
agaacccaa |
122 |
Q |
| |
|
||| ||||| |
|
|
| T |
47081830 |
agaccccaa |
47081838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University