View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17836_low_59 (Length: 236)

Name: NF17836_low_59
Description: NF17836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17836_low_59
NF17836_low_59
[»] chr4 (1 HSPs)
chr4 (7-148)||(35768307-35768451)


Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 7 - 148
Target Start/End: Complemental strand, 35768451 - 35768307
Alignment:
7 cagcaagggccacagcccccctggacatttttaaaaaaccgacaatactag----tatgctattaaaataacaacccttgaattttttactctactttgg 102  Q
    ||||||||||||||| |||| ||||| ||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||    
35768451 cagcaagggccacagtcccc-tggacttttttaaaaaaccgacaatactagctagtatgctattaaaataacaacccttgaattttttactctactttgg 35768353  T
103 gaaaaaggacaacggttaagccctacaatagtaaccaaaatatgtg 148  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
35768352 gaaaaaggacaacggttaagccctacaatagtaaccaaaatatgtg 35768307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University