View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17836_low_62 (Length: 231)
Name: NF17836_low_62
Description: NF17836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17836_low_62 |
 |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0311 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 2617 - 2389
Alignment:
| Q |
1 |
aagtagggagattacaaattgcattat-----ctcctatgtttctgaaacctgtgttcatatccccttcagtttcatttatatgaagatgtcgtttcgaa |
95 |
Q |
| |
|
|||| |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2617 |
aagttgggagattacaaattgcattcttgattctcctatgtttctgaaacctgtgttcatatccccttcagtttcatttatatgaagatgtcatttcgaa |
2518 |
T |
 |
| Q |
96 |
ttgatttttcatcagatggacgttggaaaaagttcaaaataagtctcttatgcattaagatgaaaaatcaaaataggggaaaacagtgaaacata----- |
190 |
Q |
| |
|
| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || || |
|
|
| T |
2517 |
tatatttttcatcagatggacattggaaaaagttcaaaataagtctcttatgcattaagatgaaatatcaaaataggggaaaacagtaaagtttaggaaa |
2418 |
T |
 |
| Q |
191 |
-ataactcccagggctacttcatctcact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2417 |
cataactcccagggctacttcatctcact |
2389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 115
Target Start/End: Original strand, 25636414 - 25636521
Alignment:
| Q |
6 |
gggagattacaaattgcattatctcctatgtttctgaaacctgtgttcatatccccttcagtttcat-ttatatgaagatgtcgtttcgaattgattttt |
104 |
Q |
| |
|
||||| |||||||||||| ||||| | ||||||||||||| ||| ||| || ||||||||||| ||||||||||| | ||| |||||||||||| |
|
|
| T |
25636414 |
gggaggttacaaattgcaatatcttgcaggtttctgaaacctatgtcaatacccttttcagtttcatgttatatgaaga---catttggaattgattttt |
25636510 |
T |
 |
| Q |
105 |
catcagatgga |
115 |
Q |
| |
|
|||||| |||| |
|
|
| T |
25636511 |
catcaggtgga |
25636521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University