View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17836_low_69 (Length: 201)
Name: NF17836_low_69
Description: NF17836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17836_low_69 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 58 - 95
Target Start/End: Original strand, 44680335 - 44680372
Alignment:
| Q |
58 |
tccatctctagataccttagcagaaatgttccaagcat |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44680335 |
tccatctctagataccttagcagaaatgttccaagcat |
44680372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University