View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17837_high_25 (Length: 386)
Name: NF17837_high_25
Description: NF17837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17837_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 48 - 370
Target Start/End: Complemental strand, 42359088 - 42358757
Alignment:
| Q |
48 |
taagataatagtagttatttgtcaccttttgttgcggcatatatgagccaaataggagatgacgtcgccagtaaaccaaccgtgtattgcggacgacacg |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42359088 |
taagataatagtagttatttgtcaccttttgttgcggcatatatgagccaaataggagatgacgtcgccagtaaaccaaccgtgtattgcggacgacacg |
42358989 |
T |
 |
| Q |
148 |
ttcactatccttccttctatccctgtctcctttgccgtttcaaccatcttcttcatcaacatttttgtcaacacaaaatgacctgcaccacaatat--at |
245 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42358988 |
ttcactatccttccttcaatccctgtctcctttgccgtttcaaccatcttcttcatcaacatttttgtcaacacaaaatgacctgcaccacaatattaat |
42358889 |
T |
 |
| Q |
246 |
taatta-attaaattatatgcatatcaaat------nnnnnnntttgttgtaatcttactcacctaaataattagtggcaaaggtcatttcaactccatc |
338 |
Q |
| |
|
|||||| |||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358888 |
taattatattatattatatgcatatcaaattaaaaaaataaaaattgttgtaatcttactcacctaaataattagtggcaaaggtcatttcaactccatc |
42358789 |
T |
 |
| Q |
339 |
ctcagagattgcgtgctcttctgcaaacttcc |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42358788 |
ctcagagattgcgtgctcttctgcaaacttcc |
42358757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University