View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17837_high_33 (Length: 350)
Name: NF17837_high_33
Description: NF17837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17837_high_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 242 - 333
Target Start/End: Complemental strand, 7707321 - 7707229
Alignment:
| Q |
242 |
gagcatgaagtttgtctcttaattctttttcttgaaaatggttgat-atataagagaaaatttgagagatttgattgtagaatatgcaggatt |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7707321 |
gagcatgaagtttgtctcttaattctttttcttgaaaatggttgattatataagagaaaatttgagagatttgattgtagaatatgcaggatt |
7707229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University