View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17837_high_35 (Length: 344)
Name: NF17837_high_35
Description: NF17837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17837_high_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 285
Target Start/End: Complemental strand, 34400111 - 34399841
Alignment:
| Q |
18 |
aagccccgccacctttgacaggaacaacactattaaggaggtgaaaaaatagagcatttaaggatgaggaata---caaggagaaagcaaaagaaataaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
34400111 |
aagccccgccacctttgacaggaacaacactattaaggaggtgaaaaaatagagcatttaaggatggggaataatacaaggagaaagcaaaagaaataaa |
34400012 |
T |
|
| Q |
115 |
gggatattctttggcaaaggtcatgtgaagaattctttgtctaaagttccaactactagaataataatctttctctcaaagtgaaacttgagaaaattag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34400011 |
gggatattctttggcaaaggtcatgtgaagaattctttgtctaaagttccaactacttgaataataatctttctctcaaagtgaaacttgagaaaattag |
34399912 |
T |
|
| Q |
215 |
gtttcatattttcatctaagggagaagaagaccgacttcttattggtttaatttgtcaactctttgtaaat |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34399911 |
atttcatattttcatctaagggagaagaagaccgacttcttattggtttaatttgtcaactctttgtaaat |
34399841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 285 - 337
Target Start/End: Complemental strand, 34399863 - 34399811
Alignment:
| Q |
285 |
taatttgtcaactctttggaaatggaaatccccgtccatcatatcatattctt |
337 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34399863 |
taatttgtcaactctttgtaaatggaaatccccgtccatcatatcatattctt |
34399811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University