View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17837_high_48 (Length: 274)
Name: NF17837_high_48
Description: NF17837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17837_high_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 44575824 - 44576085
Alignment:
| Q |
1 |
gcgttttcgacatgctgcaacgatcacctttgccatgtctgtaaaaacgctcccttgaggttttttgtaaatgtaagtgccgcgaccaaatagaaagatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575824 |
gcgttttcgacatgctgcaacgatcacctttgccatgtctgtaaaaacgctcccttgaggttttttgtaaatgtaagtgccgcgaccaaatagaaagatg |
44575923 |
T |
 |
| Q |
101 |
attatcgagaaagcaagacaaaccgtcggaattgcaaatcctaaagtccagcttacattagtttgaatatagacaacaccagtgagcactataacaagtg |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575924 |
attattgagaaagcaagacaaaccgtcggaattgcaaatcctaaagtccagcttacattagtttgaatatagacaacaccagtgagcactataacaagtg |
44576023 |
T |
 |
| Q |
201 |
caatggtgaaagtgaaataccaccaattaaagaagctctctaattgtccccttccctttgct |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44576024 |
caatggtgaaagtgaaataccaccaattaaagaagctctctaattgtccccttccctttgct |
44576085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University