View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17837_high_54 (Length: 226)
Name: NF17837_high_54
Description: NF17837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17837_high_54 |
 | |
|
| [»] chr5 (4 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 38300236 - 38300013
Alignment:
| Q |
1 |
attattctttatcatctttcataaatgaagatggatgggttgacaatatacctaactatacataaaaaggattattcttgagtcagcttctctacttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| || |||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38300236 |
attattctttatcatctttcataaatgaagatagatggcttaacaatatacc-aactatacagaaaaaggattattcttgagtcagcttctctacttgat |
38300138 |
T |
|
| Q |
101 |
tggattattccaatactagtttttcaataaaataagtatttgcaggaatcttgccgtttatgctagggtttattttcattatgtttgaaaattttgtagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38300137 |
tggattattccaatactagtttttcaataaaataagtatttgcaggaatcttgcag-ttatgctagggtttattttcattatgtttgaaaattttgtagc |
38300039 |
T |
|
| Q |
201 |
gattctgcagctctcagattcattat |
226 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
38300038 |
gattctgcagctatcagattcattat |
38300013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 126 - 226
Target Start/End: Complemental strand, 38292542 - 38292442
Alignment:
| Q |
126 |
aataaaataagtatttgcaggaatcttgccgtttatgctagggtttattttc-attatgtttgaaaattttgtagcgattctgcagctctcagattcatt |
224 |
Q |
| |
|
|||||||||||| | || ||||||||||| ||| ||||||||||||||||| ||||||||| ||| ||||||||| |||||||| || ||||||||||| |
|
|
| T |
38292542 |
aataaaataagtgtatgtaggaatcttgcagtt-atgctagggtttatttttgattatgtttcaaacttttgtagcaattctgcacctatcagattcatt |
38292444 |
T |
|
| Q |
225 |
at |
226 |
Q |
| |
|
|| |
|
|
| T |
38292443 |
at |
38292442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 38304446 - 38304395
Alignment:
| Q |
1 |
attattctttatcatctttcataaatgaagatggatgggttgacaatatacc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
38304446 |
attattctttatcatctttcataaatgaagatggatggcttaacaatatacc |
38304395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 38292654 - 38292588
Alignment:
| Q |
1 |
attattctttatcatctttcataaatgaagatggatgggttgacaatatacctaactatacataaaaa |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| || ||| ||||| | ||||||||||||| |
|
|
| T |
38292654 |
attattctttatcatctttcataaatgaagatagatggctttccaacatacc-acctatacataaaaa |
38292588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 38
Target Start/End: Original strand, 18745526 - 18745561
Alignment:
| Q |
3 |
tattctttatcatctttcataaatgaagatggatgg |
38 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18745526 |
tattctttatcatctttcataaataaagatggatgg |
18745561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University