View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17837_high_57 (Length: 219)

Name: NF17837_high_57
Description: NF17837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17837_high_57
NF17837_high_57
[»] chr3 (1 HSPs)
chr3 (13-88)||(42524741-42524816)


Alignment Details
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 88
Target Start/End: Original strand, 42524741 - 42524816
Alignment:
13 gattatactagttatagtacaccatcctcttcatcatatcttcctcatcatgaactccattaatctcttccccatc 88  Q
    ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42524741 gattataatagttatagtacatcatcctcttcatcatatcttcctcatcatgaactccattaatctcttccccatc 42524816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University