View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17837_low_21 (Length: 411)
Name: NF17837_low_21
Description: NF17837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17837_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 117 - 393
Target Start/End: Complemental strand, 34365240 - 34364970
Alignment:
| Q |
117 |
atctaatttactctgacaatgccctcttt-taactaacaatacacggataacgtttccaccatcagattctgattgagttagaactcttgtcatcagaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||| || |||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34365240 |
atctaatttactctgacaatgccctcttgctaaccaacaatacacgtat-------ccacaatcagattctgattgagttagaactcttgtcttcagaaa |
34365148 |
T |
 |
| Q |
216 |
ccttcatttttattttatgatggatgatattattcttagggaagtgtcacacaacttgtggaataactgaatatatgacaaaatgcttgtaggtcagtta |
315 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34365147 |
ccttcattttt-ttttatgatggatgatattattcttagggaagtgtcacacaacttgtggaataactgaatatatgacaaaatgcttgtaggtcagtta |
34365049 |
T |
 |
| Q |
316 |
acactgagcctaatctagacagacaagggtttgatgat-ggaatgtcaaaactcaaaatttcaatcctccattatagta |
393 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
34365048 |
acactgagcctaatctagacagacaggggtttgatgatgggaatgtcaaaactcaatatttcaatcttccattagagta |
34364970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University