View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17837_low_51 (Length: 252)
Name: NF17837_low_51
Description: NF17837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17837_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 6324788 - 6324908
Alignment:
| Q |
1 |
tattcatgaagacaaaatagttaggctgaaacacatatagtttgactaaataacacaacaaagatctctaagaatttcactaggaagcgataatactgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6324788 |
tattcatgaagacaaaatagttaggctgaaacacatatagtttgactaaataacacaacaaagatctctaagaatttcactaggaagcgataatattgtg |
6324887 |
T |
 |
| Q |
101 |
ttatagacagaaaactgtaga |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6324888 |
ttatagacagaaaactgtaga |
6324908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 139 - 232
Target Start/End: Original strand, 6325415 - 6325508
Alignment:
| Q |
139 |
aaataaaccattgcatcctgtaaaaactatagcttgtcatatgaaaattactaaattataataaactcctaacgcgtttttcattttgacaaga |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6325415 |
aaataaaccattgcatcctgtaaaaactatagcttgtcgtatgaaaattactaaactataataaactcctaacgcgtttttcattttgacaaga |
6325508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University