View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17837_low_52 (Length: 240)
Name: NF17837_low_52
Description: NF17837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17837_low_52 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 32293457 - 32293219
Alignment:
| Q |
1 |
acaatgtgtgtattcacacatatatgctactttcctatgtttcatttgtaaaacgggtgtacttgcttcaacaaaaaaccaagggggtccattgagaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32293457 |
acaatgtgtgtattcacacatatatgctactt-cctatgtttcatttgtaaaacgggtgtacttgcttcaacaaaaaaccaagggggtccattgagaaac |
32293359 |
T |
|
| Q |
101 |
ggctgtnnnnnnntatcgataannnnnnnngtcaacttaccgattttgtgggaagggatcttcatagatattggtatataagtgttggagttcgaactcc |
200 |
Q |
| |
|
|||||| ||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32293358 |
ggctgtataaaaatatcgataattttttttgtcaacttactgattttgtgggaagagatcttcatagatattggtatataagtgttggagttcgaactcc |
32293259 |
T |
|
| Q |
201 |
gaattctccatttctcaacacttatagtttgtgagtttag |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32293258 |
gaattctccatttctcaacacttatagtttgtgagtttag |
32293219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University