View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17837_low_55 (Length: 237)
Name: NF17837_low_55
Description: NF17837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17837_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 43 - 218
Target Start/End: Complemental strand, 342358 - 342184
Alignment:
| Q |
43 |
tatgtactttaataataaatgtaaaaacatatttaaagtgagaacaaagcaagaataatttcataagtcaattgattaaaatgttatttaaatattctat |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
342358 |
tatgtactttaataataaatgtaaaaacatatttaa-gtgagaacaaagcaagaataatttcataagtcaattgattaaaatgttatttaaatattctat |
342260 |
T |
|
| Q |
143 |
cattgagattgcaacaatatatttgatattgatttacgaacaaaaaatatgtatatggcacacaaaacctgatatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
342259 |
cattgagattgcaacaatatatttgatattgatttacgaacaaaaaatatgtatatggcacacaaaacctgatatc |
342184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 342426 - 342369
Alignment:
| Q |
1 |
tgatccagttcaaaaatctta-gagcaaatagcaatactcaaatatgtactttaataa |
57 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
342426 |
tgatccagttcaaaaatcttaagagcaaatagcaatactcaaatatgtgcttcaataa |
342369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University