View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17837_low_57 (Length: 235)
Name: NF17837_low_57
Description: NF17837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17837_low_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 16 - 101
Target Start/End: Original strand, 6893943 - 6894029
Alignment:
| Q |
16 |
aatattgtagtaaaaacacttt-cccaccatctaactttcatagaatttttaattactccattcaaacgcactctaagttttctaat |
101 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6893943 |
aatattgtagtgaaaacacttttcccaccatctaactttcatagaatttttaattactccattcaaacgcactctaaattttctaat |
6894029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 158 - 218
Target Start/End: Original strand, 6894027 - 6894087
Alignment:
| Q |
158 |
aatttatgtggttgcagcaaacaaaacatggtgcctttataatcttacattatgccttttt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6894027 |
aatttatgtggttgcagcaaacaaaacatggtgcctttataatcttacattatgccttttt |
6894087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University