View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17837_low_63 (Length: 209)
Name: NF17837_low_63
Description: NF17837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17837_low_63 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 13 - 201
Target Start/End: Original strand, 6248793 - 6248981
Alignment:
| Q |
13 |
acaaacaacatagcactcagacttatatttgctcgnnnnnnnaacactatcgacctcaaacctacgacatcaaagacaaagtgatttcccaccaacaaat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6248793 |
acaaacaacatagcactcagacttatatttgctcgtttttttaacactatcgacctcaaacctacgacatcaaagacaaagtgattttccaccaacaaac |
6248892 |
T |
 |
| Q |
113 |
taagatgaccggatcaactaggcctagccaccatcaaattttcgacatcgaatgggagataatttcacaatcagatagtgatgatgatg |
201 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6248893 |
taagatgaccggaacaactaggcctagccaccatcaaattttcgacatcgaatgggagataatttcacaatcagatagtgatgatgatg |
6248981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University