View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17837_low_64 (Length: 203)
Name: NF17837_low_64
Description: NF17837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17837_low_64 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 28 - 193
Target Start/End: Original strand, 41138017 - 41138186
Alignment:
| Q |
28 |
tgttcctctccaatttgggaggtatggaataactattcttctctta----taattataatattactcttttgccttttttgattgctttgaaatgttttt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41138017 |
tgttcctctccaatttgggaggtatggaataactattcttctcttacttatacttataatattactcttttgccttttttgattgctttgaaatgttttt |
41138116 |
T |
 |
| Q |
124 |
gtattggactgggttttcttctctagtactcaacttacgacttcctcttcacctcattccctttgcttct |
193 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41138117 |
gtattggactgggttttcttctctagtgctcaacttacgacttcctcttcacctcattcccttttcttct |
41138186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University