View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17838_high_11 (Length: 341)
Name: NF17838_high_11
Description: NF17838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17838_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 12 - 323
Target Start/End: Original strand, 32689024 - 32689341
Alignment:
| Q |
12 |
agattattcttcgtggagcctgtcgaattctggaaatgtttgtctt--------cggtgaataaattcttaagcacggtctgccttcacatgcctctgcg |
103 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32689024 |
agattattcttcgtggagcctgttgaattctggaaatgtttgtcttcgactcttcggtgaataaattcttaagcacggtctgccttcacatgcctctgcg |
32689123 |
T |
 |
| Q |
104 |
ccttatctatatctatgattcttctctatgtttgtggtctttgctctagattcatggttcatcattgttatgacttgattcgtgattgttcctttgtgag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32689124 |
ccttatctatatctatgattcttctctatgtttgtggtctctgctctagattcatggttcatcattgttatgacttgattcgtgattgttcctttgtgag |
32689223 |
T |
 |
| Q |
204 |
ttgtgatcgtgatttgaagctttggtggaaaataattttcaatcatttatttagtggacctgaattaagggtactctggtaagaggttgttcatattgat |
303 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32689224 |
ttgtgatcgtgatttaaagctttggtggaaaataattttcaaccatttatttagtggacctgaattaagggtactctggtaagaggttgttc--attgat |
32689321 |
T |
 |
| Q |
304 |
gtgtcatgacagttagtatt |
323 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
32689322 |
gtgtcatgacagttagtatt |
32689341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University