View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17838_high_22 (Length: 245)
Name: NF17838_high_22
Description: NF17838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17838_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 105 - 230
Target Start/End: Complemental strand, 40153999 - 40153874
Alignment:
| Q |
105 |
cattgatcgctctcgtcaaccaccgttgtcgtcaagtcaaaaacctccttgaccaggttcttcctttttctttttcatttcttgttctttatatgtcaca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40153999 |
cattgatcgctctcgtcaaccaccgttgtcgtcaagtcaaaaacctccttgaccaggttcttcctttttctttttcatttcttgttctttatatgtcaca |
40153900 |
T |
 |
| Q |
205 |
tgctaccatctttgttcactcatatg |
230 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40153899 |
tgctaccatctttgttcactcatatg |
40153874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 10 - 64
Target Start/End: Complemental strand, 40154088 - 40154034
Alignment:
| Q |
10 |
gcataggaagccaatggaggaacatgaacaaactggaattactagtactactagt |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40154088 |
gcataggaagccaatggaggaacatgaacaaactggaattactagtactactagt |
40154034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University