View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17838_high_24 (Length: 223)
Name: NF17838_high_24
Description: NF17838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17838_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 17 - 208
Target Start/End: Original strand, 29790789 - 29790980
Alignment:
| Q |
17 |
acctgcttttctaacccaatgatggtaagctggaaggtatatgctgtcttgaacagatgaagcttcattctggaaattttctgacaatttaaagtagtgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29790789 |
acctgcttttctaacccaatgatggtaggctggaaggtatatgctgtcttgaacagatgaagcttcattctggaaattttctgacaatttaaagtagtgt |
29790888 |
T |
 |
| Q |
117 |
ttattgtgtgagaaggacaatgctgtgtggttacaattcatgtccatttcttcatcatccttgtaaagatgatctccaaactggggcctttg |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29790889 |
ttattgtgcgagaaggacaatgctgtgtggttacaattcatgtccatttcttcatcatccttgtaaagatgatctccaaactggggcttttg |
29790980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University