View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17838_high_7 (Length: 405)
Name: NF17838_high_7
Description: NF17838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17838_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 18 - 379
Target Start/End: Original strand, 21126934 - 21127294
Alignment:
| Q |
18 |
ttctccaccctctgccaccaccctaccaccacacttccgccacaacctccgccgtctccaagaaaactccctttcacagtgtctgttcacggcaggacat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21126934 |
ttctccaccctctgccaccaccctaccaccacacttccgccacaacctccaccctccccaagaaaactccctttcacagtgtctgttcacggcaggacat |
21127033 |
T |
 |
| Q |
118 |
gggaggacccatatcactggatgtccaacaccgacgatccccatttgttggaacatctcaaccgtgaaaatagttatgctgatgcattcatggctgatac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21127034 |
gggaggacccatatcactggatgtccaacaccgacgatcctcatttgttggaacatctcaaccgtgaaaatagttatgctgatgcattcatggctgatac |
21127133 |
T |
 |
| Q |
218 |
tctcaaacttcgctctcagttgtcttcagagatgaaagcacgattgcctccttctatttgcaccccacctgaacgttggggaccctggttagttttcttc |
317 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21127134 |
tctcaaacttcgctctcagttgtcttctgagatgaaagcacgattgcctccttctatttgcaccccacctgaacgttggggaccatggttagttttcttc |
21127233 |
T |
 |
| Q |
318 |
tgnnnnnnnaaacttaattagctctttacattcaaattcaattgaaataaaataattaaact |
379 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21127234 |
tg-ttttttaaacttaattagctctttacattcaagttcaattgaaataaaataattaaact |
21127294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University