View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17838_low_17 (Length: 357)
Name: NF17838_low_17
Description: NF17838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17838_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 347
Target Start/End: Original strand, 43640232 - 43640578
Alignment:
| Q |
1 |
tgtcattgcctttggttcctgtccagtgagtactccaccatagtttaaatctgaatatgctggtgaatctgattccgttgaggtggccaatggaaactat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43640232 |
tgtcattgcctttggttcctgtccagtgagtactccaccatagtttaaatctgaatatgctggtgaatctgattccgttgaggtggccaatggaaactat |
43640331 |
T |
 |
| Q |
101 |
gtgtcggctgcttggttcgtcggcgttgaagccgacgaagcaaccagcaacggtggtgtttggagaagaagaattttcgtgtttatgaggtggtggagta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43640332 |
gtgtcggctgcttggttcgtcggcgttgaagccaacgaagcaaccagcaacggtggtgtttggagaagaagaattttcgtgtttatgaggtggtggagta |
43640431 |
T |
 |
| Q |
201 |
atggttatgtttgatgggacttgagtgaggattgggttgttattggcgaggaatattgagttttctagttttatggtggggagggaattggcatgggaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43640432 |
atggttatgtttgatgggacttgagtgaggattgggttgttattggcgaggaatattgagttttctagttttatggtggggagggaattggcatgggaaa |
43640531 |
T |
 |
| Q |
301 |
gatttgtttcttttatggtggttaagcttggcgccatggtgatgatg |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43640532 |
gatttgtttcttttatggtggttaagcttggagccatggtgatgatg |
43640578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University