View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17838_low_18 (Length: 352)
Name: NF17838_low_18
Description: NF17838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17838_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 14 - 110
Target Start/End: Complemental strand, 41653003 - 41652907
Alignment:
| Q |
14 |
catcaccttaatagcttttccattcaatgtagaatgattcttgacctcaatcgcacgtattgcttcataatcaaagaaattaacattaaaattaaca |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41653003 |
catcaccctaatagcttttccattcaatgtagaatgattcttcacctcaatggcacgaattgcttcataatcaaacaaattaacattaaaattaaca |
41652907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University