View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17838_low_24 (Length: 292)
Name: NF17838_low_24
Description: NF17838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17838_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 73 - 273
Target Start/End: Complemental strand, 3895519 - 3895319
Alignment:
| Q |
73 |
ctttccaacaacagtctccttgatcttttgtgttgcatccttcgctgtctcccacgctccttgggccgtcttcttcgccatttccccagcactcttcaaa |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3895519 |
ctttccaacaacagtctccttgatcttttgtgttgcatccttcgctgtctcccacgctccttgggccgtcttcttcgccatttccccagcactcttcaaa |
3895420 |
T |
|
| Q |
173 |
gcctctgtcgccgacccagcaacctcccccgtcttctctgccgttttctcagctccttcttttgtcttatcagccatgtaactcgctccttccttggttc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3895419 |
gcctctgtcgccgacccagcaacctcccccgtcttctccgccgttttctcagctccttcttttgtcttatcagccatgtaactcgctccttccttggttc |
3895320 |
T |
|
| Q |
273 |
t |
273 |
Q |
| |
|
| |
|
|
| T |
3895319 |
t |
3895319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 15 - 51
Target Start/End: Complemental strand, 3895574 - 3895538
Alignment:
| Q |
15 |
catcatctactactacaccagaaccaccactaccacg |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3895574 |
catcatctactactacaccagaaccaccactaccacg |
3895538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University