View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17838_low_25 (Length: 284)
Name: NF17838_low_25
Description: NF17838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17838_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 222
Target Start/End: Complemental strand, 47266320 - 47266111
Alignment:
| Q |
13 |
aaaatatgttttccatacacactaacaaggaattgaatccccgactaaattattaaggcacccaaacctataatacttgtgtcacactagattggtatta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47266320 |
aaaatatgttttccatacacactaacaaggaattgaatccccgactaaattattaaggcacccaaacctataatacttgtgtcacactagatcggtatta |
47266221 |
T |
 |
| Q |
113 |
gaagttagaaccatatatagctttacctcgtctctgttgtatgtattatcggtaataaagcataattcttcaacatggggtgggttagtatcttcatact |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47266220 |
gaagttagaaccatatatagctttacctcatctctgttgtatgtattatcggtaataaagcataattcttcaacatggggtgggttaatatcttcatact |
47266121 |
T |
 |
| Q |
213 |
tccttttatg |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
47266120 |
tccttttatg |
47266111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University